Variable number tandem repeats

Variable Number Tandem Repeat DNA A Tandem repeat is defined as the repeated end-to-end duplication of a core DNA sequence at a defined locus (Webster). Because of their variation between individuals, these DNA segments are useful for identifying individuals for such purposes as linking a suspect to a crime scene. These are the famed "DNA fingerprints". The term "tandem" is often used to describe systems in which two parts are linked together, such as "tandem bicycle" (a bicycle built for two), "tandem jump" (a parachute jump in which student and instructor are tied together in the same harness), "tandem carriage" (a carriage drawn by two horses harnessed together), etc. Hence, a "tandem repeat" is DNA consisting of short, repeated base pair sequences "harnessed" together. (example: gatagatagatagatagata is a tandem repeat consisting of five repeats of tandem "GA" and "TA") Tandem repeat DNA sequences are also called "satellite DNA." There are three main types: A satellite is a highly repetitive DNA sequence with each repeated sequence ranging from a thousand to several thousand base pairs. The entire satellite can be up to 100 million base pairs long, and tend to occur in regions of heterochromatin (tightly wound regions of DNA that are usually not very actively transcribed; found near centromeres and telomeres, among other places.) !). Satellites are abundant on the Y chromosome, which makes a handy tool for those studying paternal genetic transmission in mammals. A minisatellite is an array of tandem repeats, with each repeat ranging from nine to 100 base pairs (but most commonly around 15 base pairs). The entire array is usually 500 to 30,000 base pairs long. These are most commonly found in euchromatin regions of the chromosome. A microsatellite is an array of very short repeats (2-6 base pairs each), with the entire array ranging from 10,000 to 100,000 base pairs in length. They have so far been found in the euchromatin regtions of vertebrate, insect and plant chromosomes. The number of repeats varies among individuals in a population, making microsatellites particularly useful to the population geneticist. Microsatellites... have many loci each have a high rate of mutation (10-3 - 10-4 mutations/site/generation, as opposed to 10-8 - 10-9 mutations/site/generation as in single nucleotide polymorphisms (SNPs) found throughout the genome in introns exons regulatory regions nonfunctional DNA sequences more rarely, in coding sequences (in trinucleotide repeat form) Microsatellites are screened from a genetic library, and the data stored in a computer by a Bioinformatics specialist. They are then part of a database of readily accessible, species-specific microsatellites that can be used to sequence and compare across genomes or within a species. #geneticCode #rRNA #eukaryotes #chromatid #proteins #mitosis #Morphogenesis #GeneStructure #ChromosomeArm #prokaryotes #TumorCells #GeneticsExamQuestionsSolutions #geneExpression #Isochromosome #Anaphase #DaughterCells #viruses #SisterChromatid #chromosome #Cancer #metaphase #rnaSplicing #genotype #Iherb #tRNA #centromeres #genes #phenotype #TurnerSyndrome #transcription #NikolaysGeneticsLessons #VariableNumberTandemRepeat #DNASequence #DNASegments #telomeres https://www.youtube.com/watch?v=di2trf2g8rw

Иконка канала Nikolay's Genetics Lessons
46 подписчиков
12+
22 просмотра
3 года назад
12+
22 просмотра
3 года назад

Variable Number Tandem Repeat DNA A Tandem repeat is defined as the repeated end-to-end duplication of a core DNA sequence at a defined locus (Webster). Because of their variation between individuals, these DNA segments are useful for identifying individuals for such purposes as linking a suspect to a crime scene. These are the famed "DNA fingerprints". The term "tandem" is often used to describe systems in which two parts are linked together, such as "tandem bicycle" (a bicycle built for two), "tandem jump" (a parachute jump in which student and instructor are tied together in the same harness), "tandem carriage" (a carriage drawn by two horses harnessed together), etc. Hence, a "tandem repeat" is DNA consisting of short, repeated base pair sequences "harnessed" together. (example: gatagatagatagatagata is a tandem repeat consisting of five repeats of tandem "GA" and "TA") Tandem repeat DNA sequences are also called "satellite DNA." There are three main types: A satellite is a highly repetitive DNA sequence with each repeated sequence ranging from a thousand to several thousand base pairs. The entire satellite can be up to 100 million base pairs long, and tend to occur in regions of heterochromatin (tightly wound regions of DNA that are usually not very actively transcribed; found near centromeres and telomeres, among other places.) !). Satellites are abundant on the Y chromosome, which makes a handy tool for those studying paternal genetic transmission in mammals. A minisatellite is an array of tandem repeats, with each repeat ranging from nine to 100 base pairs (but most commonly around 15 base pairs). The entire array is usually 500 to 30,000 base pairs long. These are most commonly found in euchromatin regions of the chromosome. A microsatellite is an array of very short repeats (2-6 base pairs each), with the entire array ranging from 10,000 to 100,000 base pairs in length. They have so far been found in the euchromatin regtions of vertebrate, insect and plant chromosomes. The number of repeats varies among individuals in a population, making microsatellites particularly useful to the population geneticist. Microsatellites... have many loci each have a high rate of mutation (10-3 - 10-4 mutations/site/generation, as opposed to 10-8 - 10-9 mutations/site/generation as in single nucleotide polymorphisms (SNPs) found throughout the genome in introns exons regulatory regions nonfunctional DNA sequences more rarely, in coding sequences (in trinucleotide repeat form) Microsatellites are screened from a genetic library, and the data stored in a computer by a Bioinformatics specialist. They are then part of a database of readily accessible, species-specific microsatellites that can be used to sequence and compare across genomes or within a species. #geneticCode #rRNA #eukaryotes #chromatid #proteins #mitosis #Morphogenesis #GeneStructure #ChromosomeArm #prokaryotes #TumorCells #GeneticsExamQuestionsSolutions #geneExpression #Isochromosome #Anaphase #DaughterCells #viruses #SisterChromatid #chromosome #Cancer #metaphase #rnaSplicing #genotype #Iherb #tRNA #centromeres #genes #phenotype #TurnerSyndrome #transcription #NikolaysGeneticsLessons #VariableNumberTandemRepeat #DNASequence #DNASegments #telomeres https://www.youtube.com/watch?v=di2trf2g8rw

, чтобы оставлять комментарии